GAPDH Human qPCR Primer Pair (NM_002046)
Cat# HP205798
Size : 200reactions
GAPDH Human qPCR Primer Pair (NM_002046)
SKU
HP205798
qSTAR qPCR primer pairs against Homo sapiens gene GAPDH
2 Weeks*
| Product Data | |
| Locus ID | 2597 |
|---|---|
| Forward Sequence | GTCTCCTCTGACTTCAACAGCG |
| Reverse Sequence | ACCACCCTGTTGCTGTAGCCAA |
| ACCN | NM_002046, NM_002046.1, NM_002046.2, NM_002046.3, NM_002046.4, NM_002046.5, BC009081, BC009081.1, BC001601, BC004109, BC013310, BC020308, BC023632, BC025925, BC026907, BC029340, BC029618, BC083511, BE893087, BG724119, BI463134, BM763361, BT006893, BU155402, NM_002046.7 |
| UniProt ID | P04406 |
| Synonyms | G3PD; GAPD; HEL-S-162eP |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
Write Your Own Review
| Product Manuals |
| FAQs |
|
Related Products
Check items to add to the cart or
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.